string split - Getting Python to read a text file in chunks of 3 (codons) and give me an output -


i have text file containing 3 columns - stop codon, skipping context , sequence of 102 bases come after skipping context looks bit

tag gttagct ctcgtggtcctcaaggactcagaaaccaggctcgaggcctatcccagcaagtgctgctctgctctgcccaccctgggttctgcattcctatgggtgaccc tag gttagct cttattcccagtgccagctttctctcctcacatcctcataatggatgctgactgtgttgggggacagaagggacttggcagagctttgctcatgccactc tag gttagct ctattgtgtaactgagcaattcttttcactcttgtgactatctcagtcctctgctgttttgtaactggtttacctctatagtttatttatttttaaatta 

etc...

i want know how can write program read 3rd column of text file (i.e. 102 base sequence) , need read in chunks of threes , pick out stop codons sequence - 'tag', 'tga', or 'taa' , create list or table or similar tell me if each sequence contains of these stop codons , if so, how many.

so far have done python read 3rd column of text file:

infile = open('test stop codon plus 102.txt', 'ru') outfile = open('tag plus 102 reading inframe.txt', 'w')   line in infile:     parts = line.split('\t')     stopcodon = parts[0]     skippingcontext = parts[1]     plus102 = parts[2]` 

but i'm not sure go next.

thanks in advance!

to read 102nt sequence 3 3:

by3 = [plus102[i:i+3] in range(0,len(plus102),3)] 

to find position (in sequence) of stop codons in it:

stops = [(3*i,x) i,x in enumerate(by3) if x in ["tag","tga","taa"]] 

do need consider phase also?

to write file:

g = open("outfile.txt", "w") (i,x) in stops:     g.write("stop codon " + x + " found @ position " + str(i) + "\n") g.close() 

you may consider string formatting, tab-delimited output (see join), etc.


Comments

Popular posts from this blog

how to display 2 form fields on same line with bootstrap -

How do you convert a timestamp into a datetime in python with the correct timezone? -